General

Quality Trim and Filter

1. Before Trimming

   Before	Stats
   Reads	331,126
   Total Bases	50,000,026 bp
   Mean Read Length	151.00 bp

2. After Trimming

   After	Stats
   Reads	331,026 (99.97 %)
   Total Bases	49,984,926 (99.97 %) bp
   Mean Read Length	151.00 bp
   Paired Reads	330,930 (99.97 %)
   Paired Total Bases	49,970,430 (99.97 %)
   Unpaired Reads	96 (0.03 %)
   Unpaired Total Bases	14,496 (0.03 %)

   Quality Report [full]

   Read Length [full]

   Nucleotide Cont [full]

   GC Content [full]

Link to | QC Report PDF | Directory

Host Removal

Host file: /opt/apps/edge/edge_ui/EDGE_input/Host/Human_ref_GRCh38_all/human_ref_GRCh38_all.fa,/opt/apps/edge/edge_ui/EDGE_input/Host/Inverterbrate_Vectors_of_Human_Pathogens/all_vector.fa.

Host Removal Stats [full]

Link to | Report PDF | Directory

De Novo Assembly

1. General

   Assembly	Stats
   Number of contigs	1,367
   N50	6,128 bp
   Max contig size	36,181 bp
   Min contig size	267 bp
   total assembly size	4,228,447 bp

   Contig Length [full]

   GC Content [full]

   Link to | Report PDF | Contigs Fasta | JBrowse | Directory

2. Assembly validation by read mapping

   Mapped	Stats
   Number of Mapped Reads	279,127
   % of Total Reads	96.75 %
   Number of Unmapped Reads	9,378
   % of Total Reads	3.25 %
   Average Fold Coverage	7.77 X

   Link to | Mapping Plot | JBrowse | Directory

3. Annotation

   Annotation	Stats
   CDS	4,031
   rRNA	4
   tRNA	49

   Show annotation result using JBrowse in [fullwindow] or [inline]

   Link to | GFF3 | GenBank | Directory

Reference-based Analysis

Reference file: /opt/apps/edge/edge_ui/EDGE_input/Reference/Escherichia_coli_str._K-12_substr._MG1655/NC_000913.gbk

1. Contigs mapped to reference

   Analysis	Stats
   Number of Mapped Contigs	1,367
   % of Total Contigs	100.00 %
   Average Fold Coverage	0.96 X
   Linear Coverage	92.2247%
   SNPs	251
   InDels	17

   Reference	Name	Length	GC(%)	Avg Fold(X)	Base Coverage(%)
   NC_000913	Escherichia coli str_ K-12 substr_ MG1655 chromosome, complete genome	4,639,675	50.79	0.96	92.22

   Show contigs mapping to the reference using JBrowse in [fullwindow] or [inline]

   Link to | Plot | JBrowse | Directory

2. Reads mapped to reference
   1. Mapped Reads

      Analysis	Stats
      Number of Mapped Reads	285,649
      % of Total Post-QC Reads	99.01 %

      Reference	Name	Ref len	Ref GC%	Mapped reads	Ref recovery%	Avg fold(x)	Fold std	# of Gap	Total Gap bases	# of SNPs	# of INDELs
      NC_000913	Escherichia coli str_ K-12 substr_ MG1655 chromosome, complete genome	4,639,675	50.79	285,649	94.46%	7.32	4.60	2,494	256,943	63	0

      Coverage [full]

      Fold histogram [full]

      Show reads mapping to the reference using JBrowse in [fullwindow] or [inline]

      Link to | Plot | JBrowse | Directory

   2. Unmapped Reads

      Unmapped	Stats
      Number of Unmapped Reads	2,856
      % of total reads	0.99 %

      Heatmap (species) [full]

      Radar map at species level [fullwindow]

      Link to | Summary table | Abundance | Directory

Community Profiling

Profiling results of unmapped reads to the reference.

1. General

   Tool	Rank	Top1	Top2	Top3	Top4	Top5
   bwa	species	Escherichia coli	Achromobacter xylosoxidans	Alteromonas macleodii	Shigella flexneri	Shigella sonnei
   gottcha-speDB-b	species	Escherichia coli	N/A	N/A	N/A	N/A
   gottcha-speDB-v	species	N/A	N/A	N/A	N/A	N/A
   metaphlan	species	N/A	N/A	N/A	N/A	N/A
   metaphyler-srv	species	N/A	N/A	N/A	N/A	N/A
   kraken_mini	species	Escherichia coli	Achromobacter xylosoxidans	Shigella sonnei	Delftia acidovorans	Streptococcus suis

   Heatmap (species) [full]

   Radar map at species level [fullwindow]

   Link to | Summary table | Abundance | Directory

2. BWA (reads mapping)
   Tree plot at species level [fullwindow]

   Krona plot at species level [fullwindow]

   Link to | Abundance | Directory

3. GOTTCHA (bacterial database)
   Tree plot at species level [fullwindow]

   Krona plot at species level [fullwindow]

   Link to | Abundance | Directory

4. GOTTCHA (viral database)
   [Not available]
5. Metaphlan
   [Not available]
6. Metaphyler-Srv
   [Not available]
7. Kraken (mini database)
   Tree plot at species level [fullwindow]

   Krona plot at species level [fullwindow]

   Link to | Abundance | Directory

SNP Phylogeny

Selected database: Ecoli

Link to | SNP | Alignment (all) | Alignment (cds) | Directory

PCR Assay Analysis

1. Primer Validation

   Validate primers binding to contigs - SUCCESS!

   Validate primers binding to reference - SUCCESS!

   Contig	Location	Product Size
   Ecoli_10x_221	4336..4958	623
   NC_000913	3957949..3958571	623

   PCR Validation [full]

   Link to | JBrowse | Report PDF | Directory

2. Primer Design

   Primer Name	Location	Forward Primer	Forward Tm	Reverse Primer	Reverse Tm	Size	Background
   Ecoli_10x_186-1	2519..2855	TGCACGACGCCGAACTAC	60.4 C	GTGCCGGGTAAGTGCACC	61.1 C	337 bp	[44.33 C] Escherichia coli str. K-12 substr. W3110
   Ecoli_10x_213-1	5157..5359	CTGGTGGCGTTCAACAATGA	59.0 C	TTACGGAAGCCCTCCATCAG	59.2 C	203 bp	[50.58 C] Escherichia coli UM146 chromosome
   Ecoli_10x_400-1	3100..3319	GCGCAACAGCTGAATATCGA	59.1 C	TCAGGTTATGCCGTTTCGTG	58.6 C	220 bp	[42.38 C] Escherichia coli ETEC H10407
   Ecoli_10x_444-1	2730..2941	TCGCAATTTGTTGAATTTGCAGA	58.6 C	TGTCGCCCTTTGTTGAGAAC	58.7 C	212 bp	[46.19 C] Escherichia coli W chromosome
   Ecoli_10x_559-1	1946..2146	TACCGGCTGGCTGGCAAA	62.0 C	TTGGCTGGCGGGGAGTTATT	61.9 C	201 bp	[52.90 C] Escherichia coli PMV-1 main chromosome

   Link to | JBrowse | Result | Directory

Show primer validation/design result using JBrowse in [fullwindow] or [inline]